Strain Information | |
---|---|
DGRC Number | 104906 |
Genotype with FlyBase Link | y[*] w[*]; P{w[+mW.hs]=GawB}CG1358[NP5221] / CyO, P{w[-]=UAS-lacZ.UW14}UW14 |
Genotype | y* w*; P{w+mW.hs=GawB}CG1358NP5221 / CyO, P{w-=UAS-lacZ.UW14}UW14 |
Break points/Insertion Site | 43E3 |
Map Viewer | |
Related Genes | CG1358 scra I-element{}769 |
Original Number | 5221 |
Chromosome | 2 |
Comments | FlyBase Insertion: P{GawB}NP5221 NP line. Received from the National Institute of Genetics. |
Balancer | CyUW14 |
Cluster id | 568 |
General Information | NP_lines |
Genus | Drosophila |
Subgenus | Sophophora |
Species Group | melanogaster |
Species Subgroup | melanogaster |
Species | melanogaster |
Embryonic Expression | weak. Keilins organ (only after cuticle deposition)? amx |
Larval GFP | sg. trachea. (s.g.) |
Larval X-gal | not in discs. (s.g.) |
Adult GFP | part of probosis. internal. |
Reference | Hayashi S, Ito K, Sado Y, Taniguchi M, Akimoto A, Takeuchi H, Aigaki T, Matsuzaki F, Nakagoshi H, Tanimura T, Ueda R, Uemura T, Yoshihara M, Goto S. GETDB, a database compiling expression patterns and molecular locations of a collection of Gal4 enhancer traps. Genesis (2002) 34(1-2) 58-61 [RRC reference] |
Last update | 2020-04-03 |
Research papers using this strain [Please submit your publication] |
Cavanaugh DJ, Geratowski JD, Wooltorton JR, Spaethling JM, Hector CE, Zheng X, Johnson EC, Eberwine JH, Sehgal A. Identification of a circadian output circuit for rest:activity rhythms in Drosophila. Cell (2014) 157(3) 689-701 [PubMed ID = 24766812] [RRC reference] Hayashi S, Ito K, Sado Y, Taniguchi M, Akimoto A, Takeuchi H, Aigaki T, Matsuzaki F, Nakagoshi H, Tanimura T, Ueda R, Uemura T, Yoshihara M, Goto S. GETDB, a database compiling expression patterns and molecular locations of a collection of Gal4 enhancer traps. Genesis (2002) 34(1-2) 58-61 [PubMed ID = 12324948] [RRC reference] |
Stock Request |
Library & Clone Information |
---|
Library Name / Clone Name | np / np49185_0912 |
Strand | Minus |
Insertion Point | 2658731 |
Chromosome Band | 2R |
Flanking Sequence | gnnngggnggngngnncgccaggggnnngggggtnnngttttttngnngggntactgggg gcannaccttnttgtgtacttncggtaagncttcggctatcgacgggcaccaccttatgt tatttcatcatgCNNTGNAGCNTTCATACACTCTANACNTACATAAACACACACTNTGCA TATGTGTNACNCNNNGNATTTNTAACAGTNGNAAACTAAATGCATATGCCATAAACCATT AGGCNNGAACAGAAAGCATNAAAAGTGATAATCCNATAATAAATGTCTACTTTTGGCAGN TNNCNAGGACAAACCACCCACTCCGCCATCCGCCGCCCAGGAGGCAGCCCAGCNCTNGGA AAGTCCCGGNGCGGAGCAAGNCAGCTTCANGCAGGCGCTNAAGAACCTGANGACCAACCG GNACTTNATCTTACTGCTCCTCTCGGACGGCATCAATGTGGGCGTCTTTTACGCCATTTC CACGCTCCTCAATCCGGTACGAACATACTTCGCATACTTCCACTCGATTAATGAGCGGCT GCTAATGGGGTCTTATTGCTGGgatcgaagaatacataagagagaaccgncgccaaagaa cccattattgntggggtccgttttcaggaagggcaagccatccgacatgtcatcctcttc agaccaatcaaatccatgaagagcatccctgggcataaaatccaacggaattgnggagtt atcatgatgagctgccgagtcaatcgatacagncaactgnctttgaccttngntactact ctcttccgatgatgatgncgcacttattctatgctgnctcaatggtagaggcatatnagn ctccactgagcannnnnnnnnnnngggnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn nnnnnnnnnnnnnnnnnnnnnnnnnnnnn |